Search the Community
Showing results for tags 'AG'.
Found 415 results
-
My first proper go at a fully stickered GARC racer. I designed the engine first, then it took several iterations to figure out a body design that I felt suited it. The stickers took about three hours, then my eyes gave up but it's my first go so I'm really pleased with the outcome. Mostly the cut-to-size hexagon pattern from a Super Heroes Brainiac set. Here's the energy core which is mostly hidden from view. And here's the underside: There's more photos on my Flickr feed. Thanks for looking. Luc.
-
Location: H04 Crofter's Ridge Tags: Civil Building Previously... // PERSONAL DIARY // As we moved into the lab itself I was struck by the fact that I had no idea what anything in here was or did. It looked very advanced, but like nothing I had seen before. I couldn't tell if it was alien or something we had come up with that was very advanced. And there was none of the usual machinery noise, it was so silent. Punctuated further by the lack of people other than our team. Although I did notice what appeared to be an observation room with double heavy armored glass and atomic level filtering. That observation room would keep even these soldiers out for a while and be able to fully filter anything we might use on it at the same time. But why would a lab need that level of security? The team was on alert and seemed pretty worried and edgy. I did my best not to let on that this was all completely unknown to me and that I had no idea if an errant shot would take out half the planet or release something toxic. It kept ringing in my head that no one was here, and that seemed the most out of place. Even if there were no people, being an Octan lab I would have expected robots and droids doing work, but there was nothing. The Major said we should keep going ahead to the elevator and see what was in the sub-levels. As much as I just wanted to get out of there my scientific curiosity kept me going. I also hoped that the lack of anyone or anything would continue, as the alternative seemed much scarier. Extra Pics: All the pics: https://www.flickr.c...4/shares/7Bf6tb
-
Location: E11 - The Fascini Cluster Tags: Land Vehicle, Exploration Dramatis Personae: Previously: http://www.eurobrick...howtopic=138264 Currently, in the Fascini Cluster... What am I doing on a poop asteroid again?!?! The fact that we found one at all is a major coup, Eshey. Space whales are not as abundant as they used to be, due to illegal space whaling activity. This is our chance to get a lot of rare poop samples for Dr. Long. Holy avocados! There are poops aliens here! I have no weapons!!! Stand down, Eshey! It seems they are trying to communicate. Frrrrrr. Frrrrrrrrrrrrrr. Frrrrr. Frr. Frrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrr. Frrrrrrrrrrrrrrr. Frrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrr. Frrrr. Frrrrrrrrrrrrrrrrrrrrrr. Frrrrrrrrrrrrrrrrrrrrrrrr. You're Lolita and your friend is Chastity, and you're both exotic dancers? Frrr. Frrrrrrrrrrrrrr. Frrrrrrrrrrrrrrrrrrrr. Frrrrrrrrrrrrrr. Frrrrrrrrrrrrrrrr. Frrrr. F. Frrrrrrrrrrrrrrrr. Frrrrrrrrrrrrrrrrr. Frrrrr. Frrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrr. Frrrrrrrrrrrrrrr. Frrrrrrrrrrrrrrrrrrrrrrrrrrrrrr. Frrrrrrrr. And you're inviting us to the gentleman's club on this poop asteroid? No cover charge, two drink minimum? Hold on, I'm taking a shuttle transport right over! Comments and criticisms are all welcome!
-
Dramatis Personae: Thank you, Sue and Eshey, for joining me as I inspect one of Octan's entries into the mech wrestling competition for the 2016 Space Olympic Games here in Andromeda. Glad to be here, sir. Thanks for inviting me. I'm just happy that the corporations in Andromeda are trying to improve their relations. So, sir, what is our strategy for this entry? Everyone thinks that wrestling is about physical strength and technique. Isn't it, sir? That's what small minds think, Eshey. However, this entry will win by completely outsmarting its opponents. Meet Octan's big head wrestling mech! What in the av...the av...av...oh my.... Something wrong, Eshey? I...I don't believe it. I've run out of avocados to give. That sounds like something you should have looked at. It comes equipped with a giant neuroprocessor made up of 1 billion parallel quantum processors capable of handling up to 500 exabytes of information every 100th of a second. Impressive. It comes with three personalities to allow it to adapt to different situations quickly, each represented by a different face. This also offers the mech 360 degree vision, meaning that no opponents can ever sneak up on it. It can be its own friend and form its own clique. It also comes equipped with a timer and headlamps for wrestling in the dark. That's my favorite kind of wrestling. This mech is just a giant head! How can it wrestle? Sigh. By outsmarting its opponents. Don't you listen, Eshey? What about physical attributes?! Don't you ever play any role playing games, Eshey? You only have so many points to allocate for stats. In this case, all the points were put into Intelligence. No one ever creates a well-rounded role playing character. How is it supposed to wrestle with such tiny arms?! You know who else had tiny arms, but dominated its opponents, Eshey? Tyrannosaurus Rex. I think it's pretty clear that this mech will be as powerful and dominating as Tyrannosaurus Rex. Comments and criticisms are all welcome!
-
Location: E11 - The Fascini Cluster Tags: Land Vehicle Dramatis Personae: Previously: http://www.eurobrick...howtopic=137986 Currently, in the Fascini Cluster... Thanks for field testing our latest vehicle, Eshey. What in the avocado is this?!?! It's Octan's latest artillery mech. I call it the Compensator. It's all sorts of wrong! Hmm? I thought you liked firepower. Comments and criticisms are all welcome!
-
Location: H04 Crofter's Ridge Tags: Land Vehicle, Civil Building Previously... // PERSONAL DIARY // The Major came to see me and said that my expertise was needed for a very important mission that he and his team were undertaking. I asked him what I could help with and he said that they needed me to go with them to a lab on Crofter's Ridge. I wasn't sure which lab he was referring to and he said it "wasn't one you have heard of." I explained that I was a senior executive and one of the top scientists, so I knew about all the labs and he just said "not this one." I was a bit nervous at this, particularly knowing The Major's line of work, but he told me that good leaders "lead from the front, not behind a desk!" I certainly want to be a good leader! As we boarded the shuttle to head down to the planet's surface I couldn't help but notice that all the other team members wore heavy armor and had plenty of weapons. I asked The Major about my own armor and weaponry and he replied that we didn't know what sort of situation we were heading into and that it would be safer for me if whatever was down there thought of me as a civilian instead of a warrior. It did sort of make sense so I agreed. Once on planet we went down an elevator with The Major's team armed and ready to roll and with me driving a small utility vehicle with tools. Once we reached the floor The Major's team went about securing the area. Which proved unnecessary since there was nothing there. Apparently we were in a kind of outer zone and one of the warriors named Cheyenne (though everyone called her Cyborg) worked at bypassing the security systems to permit us entry to the inner area. I'm not quite sure what happened to her that caused her to have the cybernetic implants, but she clearly wasn't comfortable talking about it. Even after I had asked her and she said it was from "a faraway place she would never go back to." And when I asked her where and why not she just shook her head and stayed quiet. I have to admit it was a bit creepy being in there. There was no real sign of anyone having been there and it was not very well lit. It was eerily quiet, and though the filtration system in my helmet prevented me from smelling anything, the readout showed the air was abnormally clean. I could sense a tension among the soldiers, though The Major did his utmost to hide it. I wanted to point out again that I was an executive now and that it seemed like maybe not ideal to have me along, but I knew it was too late for that argument. They needed my scientific expertise to investigate a lab that was so top secret even I didn't know about it. Extra Pics:
-
Location: C04 - Aeristus Tags: Military, Building. Previously on Andromeda's Gates: The mark, Uplink, Pay dirt. Departure. Chapter 5: The Gyrocube. Gedron Briskett rapped the fingers of one hand irregularly on the table while he scanned the details on the digi-page he held in the other. Yseult sat, arms folded, opposite him getting increasingly impatient. Being in M.A.N.T.I.S., she thought to herself, seems to involve a lot of sitting at tables waiting for people to think of something to say to me. She shifted her position in her seat, as loudly and obviously as she was able to. Briskett briefly looked up from the digi-page, then promptly ignored her and went back to looking over whatever report they’d compiled on her for his benefit. “The Brawling Beauty.” He finally said with a half-raised eyebrow. Yseult tensed at the name. The Beauty was something she thought about almost every day, but talked about… never, and she didn’t like to – especially not with some ‘full of himself’ desk pilot she’s never met before. “You’re a freight pilot then?” he continued, laying the digi-page on the table in front of him. “who got caught pulling short cons on that swamp-infested mudhole…” he paused for a moment in clear belief that he was about to say something clever, “…without a ship”. He tried to let the irony hang for a moment but her ability to look unimpressed got to him before his increasingly annoying personality got to her. “Box Runners are ten-a-credit.” He continued, “What does that mad scientist think we need the likes of you for?” ‘Box Runner’ was a slang term for small independent freight operators. Hearing it brought back memories, the briefest moment of nostalgia. Don’t go back there, it was a different time, you were a different person. “How should I know?” she responded, dismissively. “You made a deal, I got you the credits back, you owed me a new bike… Now I just stick around until you give a reason to leave.” She knew that prospect would please him. “Fine.” he said, as if trying to out-scheme her, “We’ll put you though our usual pilot assessment and see where it spits you out.” A cocky smile had developed upon his face. The gyrocube was a full-rotation simulator designed to test a pilot’s ability to separate visual, auditory and gravitational sensory inputs and decide which to trust and how to react. The program’s scenarios mostly involved being in a spacecraft that was wildly out of control and dangerously close to hitting a planet, or something to that effect. Yseult sat in the pod at the centre of the device, intense concentration on her face. She’d flown through the ‘principles of spaceflight’, ‘astro-navigation’ and ‘Gate dynamics’ tests, that was expected, but freighters weren’t known for their manoeuvrability and rarely got into unstable high-G situations. This is where they expect me to fail, she thought as she felt the grips of the controls in her hands… But they never flew with me. Dragging the rear of the simulated ship round and down, the imitation ‘gravitational anomaly’ put her in a flat yaw spin with an edge of pitch climb. Her feet had countered the spin a little, reacting immediately with rudder thrust but it would never have been enough. It feels like roll but it isn’t, don’t fall for it. She countered intuitively, using the rudder and bursts of opposing roll control in time with the rate of rotation to halt the spin. Now she was cartwheeling down a rapidly decaying orbit. Briskett stood beside the operator in the control booth, a look of annoyance already on his face. “She’s arresting the decay.” The operator announced. “She’ll maintain orbit at this rate.” “I can see that!” Briskett retorted. He thought for a moment. “Blow the starboard nose thrusters.” He ordered. The operator hesitated. “Those are the one’s she’s using to stop the spin” he informed. “I know.” Briskett snapped back. “Blow them”. With the ship gently rolling on its axis, Yseult had to wait to be facing the right way every time she used a thruster or it would only make things worse. With the flat spin almost under control, she made one final burst… The simulated explosion set off every alarm and for the briefest moment, she lost track of which way she was facing. Red warnings lit up on her displays. The entire nose thruster assembly was inoperable. She checked the flight gyro. Now she was spinning in every direction. She tried to counter it but with so little control now, nothing seemed to work. A new alarm sounded “RE-ENTRY, RE-ENTRY.” the verbal warning announced. Air. Something I can work with. She reversed the controls and stopped trying to recover the spin. She put the engines into full reverse and opened the aerobrakes on one side at the ship’s rear; as they caught the increasingly dense atmosphere, the additional resistance encouraged the ship out of the tumble. With less air resistance than the rear of the ship, the nose stayed pointing down and the ship slid into a whirlpool-like spin. Opening the aerobrakes on the other side and increasing the roll, the ship soon became a spinning top of reverse thrust. Inside the pod, Yseult was trying hard not to throw up, or pass out. She watched the flight gyro as the rotation steadily settled into a rolling nose-dive. Just a little longer. She was still descending way too fast but arresting the roll, she finally began to pull up. In the control room, a small crowd of pilots and techs had gathered behind Briskett, watching the unknown pilot handle the ridiculous sequence of events she’d been handed and were responding far too positively for his liking. “Fail engine one.” Silence fell. He didn’t wait for the operator to hesitate this time. “Fail it”. Yseult felt the drop at the rear immediately but in an already desperate situation, using every Newton of thrust to halt her descent, it slipped away so quickly… There’s only so much you can do, but I won’t give up this time. She fought it to the end, every metre. The gyrocube came to a gentle rest and a tech helped the disoriented pilot out of the pod. She felt them holding her under an arm as she fumbled down some steps. She felt someone remove her helmet to see a fuzzy image of a man with a sickeningly wavy smirk stood before her. He said something but she didn’t hear it, she was busy convulsing as her body wrenched free of the tech and she fell to her hands and knees, vomiting when she hit the floor. She noticed some boots, splattered with sick, turn and walk away… Then she wretched and threw up again. Additional images: Environment. Closer view of backdrop. Control booth. Removable fold-down steps. Thank you for reading. Luc.
-
Location: E11 - The Fascini Cluster Tags: Land Vehicle Dramatis Personae: Previously: http://www.eurobrick...howtopic=137678 Currently, in the Fascini Cluster... Hello? Can anybody hear me? I say, this is embarrassing. Is anybody out there? Drinks for whoever responds! Anybody? Comments and criticisms are all welcome!
-
Location: H06 Farmolis Tags: Land Vehicle, Civil Building Previously... // PERSONAL DIARY // The Major expanded our training this week to include firearms. We went to a gun range and there were a large variety of weapons to practice with. The Major was there and he had 2 other instructors this time. I liked this better because unlike with the hand weapons training no one was trying to attack me. Dr. Allison seemed to want to spend most of her time getting to know one of the instructors instead of firing for some reason. I, however, enjoyed my time shooting! I know that as a man of science my place is in the lab, but boy is there a thrill being able to fire those weapons! Even with the Major up above me yelling stuff I had a great time. He kept telling me that your weapon is your best friend out in the field. That with "one in the chamber I'm always a threat!" Once more he was yelling from a vehicle, a small personal land walker this time. I think he might be hard of hearing actually and that is why he is always yelling. The combat shotgun was easily my favorite. It was pretty heavy and had a big kick, but boy was it enjoyable sending fire downrange. I know I'll never be spec ops, but it is nice getting out of the lab sometimes and being able to just have some fun. The one guy even offered to help me better blend in. Though it seemed like he mostly just stood in the corner with his goggles on. Extra Pics: More pics: https://www.flickr.c...2136@N04/Mn8DMT
-
Location: E11 - The Fascini Cluster Tags: Land Vehicle, Spaceship Dramatis Personae: Previously: http://www.eurobrick...howtopic=136916 Currently, in the Fascini Cluster... Scanning the asteroids for awesomnium now, sir. We're doing an actual assignment?! This one seems to be promising. Then set her down. It's not a poop asteroid, is it?! We've landed, sir. Where are the aliens that come out of no where with normal names and strange occupations, speaking things that only I don't understand?! Lower the ramp, Sue. Beginning my survey. There's no poop, innuendo, or bad science?! What's going on?! Comments and criticisms are all welcome!
-
Location: H06 Farmolis Tags: Land Vehicle, Civil Building ** My 52nd weekly build in AG, so I've now done a year's worth of weekly's consecutively!** Previously... // PERSONAL DIARY // We were recently sent a communication from Corporate HQ about a new program to try and make all AG staff better prepared for the harshness of our environment. I think that HQ was concerned for our safety and they tried to illustrate that by saying that losing humans came at "a significant cost." They instructed that we participate in classes led by one of their security staff, Major Richard Allcock. Being a member of the executive team I, of course, knew that I should provide a good example and therefore made sure I was one of the first trained and clearly demonstrated my enthusiasm for the effort to those around me. Dr. Allison and I reported to a training facility for our first class -- "Armed Self Defense: Use the Pointy End". Upon arriving we met the Major (he prefers to be called that), and he explained that he had brought with him some of the finest warriors to train us. They were skilled in fencing, polearms, and many other bladed weapon disciplines. One thing I noticed that was a big shift for me was that the Major always wanted us to yell our answers. If he asked if we understood something we weren't supposed to say "Yes", we should shout loudly: "YES, MAJOR!" Not something you generally do in a science lab. The Major asked Dr. Allison and myself about our military history (none), our previous armed/unarmed defense training (none), and our daily training regimen (apparently "walking to the lab" wasn't a good answer as he had me "drop and give him 20", which meant push ups I learned). Once we had established our lack of skills he went into a several minute profanity laced tirade about being barely more than targets. I attempted to point out that protection was never a concern as I had ED-208 (whom had been forbidden from attending) to keep me safe. I then learned that the Major was not a fan of robots. He asked what I would do when "that damned machine comes for my precious fluids", which I had no answer for as I had no idea what that meant. He asked if I had ever watched the classic "Terminator" series of holovids in which the inevitability of robot revolt was explored. I had not and he said that I should do my research before talking about things. I tried to explain that I had a Masters in Mechanical Engineering, a PhD in robotics and was working on a second PhD in Artificial Intelligence, but he simply said that "book learning ain't a replacement for the real thing." I was the first to face off against my instructors and they gave me a wooden practice sword so I wouldn't hurt anyone. The Major stood on his jeep (I'm not sure why he even had one in the facility or how it got in there, but he said it was necessary) and used his megaphone to yell instructions. Though mostly it was just "attack" or "defend yourself dummy!" I did my best to fend off my far more trained attackers, but it did not go well. I felt like even the training facility cats could have successfully attacked me -- especially the big smelly one. After an hour or so the Major said we were done for the day. I think all that armor must have made him really hot because he said he "needed a drink, like a gallon or so should do." I was very tired but felt like I was better prepared to face the trials of life in AG. After the class I told Dr. Allison I was going to head out to the garden outside the training facility for a bit of meditation on what I had just learned. She said she would catch up with me later and I was left alone with my thoughts. Extra Pics:
-
Location: E11 - The Fascini Cluster Tags: Land Vehicle, Civil Building Dramatis Personae: Previously: http://www.eurobrick...howtopic=136916 Currently, in the Fascini Cluster... Eshey, since I'm currently away attending the annual Brick Fiesta convention, would you mind checking on the progress in the engineering bay? Sure, I'll head on over, sir. Oh avocados...what are you guys doing in the engineering bay? Dr. Gene Hackman was helping me develop Octan's latest patrol starship. I'm buying drinks afterwards. You're welcome to join, of course. No one will believe me when I say that the vehicle is a segway and not a starship, will they? Of course, it's a starship, Eshey. How does that even look like a segway? What?! There's a viewscreen in the engineering bay! Why did you even send me down here if you could just access the view screen in the engineering bay and see for yourself? Because, Eshey, I'm not there. I'm busy at Brick Fiesta. WHAT?! YOU'RE LOOKING AT IT RIGHT NOW!!! Hold on. Wait. Why is Dr. Hackman, an astrogeneticist, working on a seg...er...a patrol starship? Shouldn't he be helping Dr. Long with her project? Oh, Dr. Long is busy meeting with royalty of some sort. You know, part of being a famous Octan scientist and all. I figured that since now is then, we could take advantage of Dr. Hackman now. I don't follow...er...let me phrase this differently...when does then become now? Later. What? In any case, Dr. Hackman is adding DNA to our starship prototype. Afterall, if our starships had DNA in them, we wouldn't have to manufacture them anymore. They could simply breed and reproduce, reducing our overhead costs. Comments and criticisms are all welcome!
-
Location: H06 Farmolis Tags: Land Vehicle, Civil Building Previously... // PERSONAL DIARY // After having a bit of a break I got back into work by helping Dr. Allison with a new speeder prototype. It was designed to be used as a long range exploration speeder for our explorer teams. It has a larger cargo capacity for more consumables and heavier lifting engines to handle the heavier load. While not designed as a high velocity speeder it can achieve very quick speeds and has a large energy output capability so it can be used to power a small encampment when needed. The underside has an armored skid and the seating area features armored plates to protect against foliage or more malicious threats. It isn't a full military vehicle, but with so many unknown alien threats this speeder should be very capable and help keep our people safe. Dr. Allison had been working on fixing the little issues she had been made aware of during testing and I was happy to help out. ED-208 kept insisting he could fix it, but all he wanted to do was use the giant sledgehammer. I doubted that even his robotic capabilities were enough to use that with precision. The prototype lab itself was a very impressive facility. Dr. Allison had modified it some to make it more in line with her personal decor tastes which isn't standard Octan practice, but I thought that Dr. Long would approve since it did seem to foster a stronger work ethic. I also like to allow people a bit of discretion when possible as it empowers them and gives them a sense of pride and ownership. I'm not saying to allow people to go crazy, I'm not pombe! But some minor personal touches do statistically prove out to be beneficial in helping an employee blur the lines a bit between work and personal time thus generally leading to more hours spent at work. Of course I'm sure many employees are like me and do plenty of work when away from the office also. The wonderful part of being so connected everywhere is that I can be out to dinner or at a park and still able to do work! Extra Pics: Side Note: I think this lab is my most "complete" facility build yet.
-
Location: C04 Aeristus Tags: Patient Record: L8C04 Patient Number: 8224(M) Facility: The Narbilu Exotic Diseases Centre, Aeristus Leading Practitioner: Dr Ando 2318h 10 Junali 3816 Patient transferred from M.A.N.T.I.S. facility in critical condition with advanced case of Marphacian Swamp Fever. Emergency treatment begun immediately. 0430h 11 Junali 3816 Patient stabilised for now after hours on the verge of death. We’re all experienced with Marphacian Swamp Fever; indeed Kawashita built the Exotic Diseases Centre on Aeristus primarily to treat the personnel stationed on Marphacia. But none of us have seen a case this bad since those terrible first weeks before we developed the treatments. Hopefully the patient will survive until morning. There’s nothing more we can do for now. 1021h 11 Junali 3816 Condition stable. 1347h 23 Junali 3816 Patient beginning to show signs of recovery after almost two weeks with no improvement. Nurses report he began vocalising this morning, which indicates the hallucination stage of recovery is starting. 1819h 26 Junali 3816 Patient’s hallucinations appear to be fairly mild, which may be a good sign, or may just reflect how little energy he has after weeks of suffering. According to nurses, he mostly mumbles incoherently about webs and spiders. 0700h 30 Junali 3816 No change in condition. 1553h 05 Julali 3816 No change in condition. Fever shows no sign of breaking. Patient continues to ramble about spider webs. 0246h 10 Julali 3816 Patient’s condition has deteriorated during the night. Fever has worsened. Patient became extremely distressed and appeared to believe he was being eaten alive as part of a giant plate of ‘larvae salad’. Is alternately terrified about being eaten and furious about salad leaves ‘ruining perfectly good larvae’. Became so violent that he had to be heavily sedated. Thanks for reading! C&C welcome!
-
Location: H06 - Farmolis Tags: Civil, Building, Land Vehicle "Welcome to Checkpoint Charlie. Please state your purpose and provide identification." "Jebediah O'Reilly, bringing a tanker of Awesomenium for Dr. Kodan Black." "Yes, you're scheduled right here. Dr. Black is expecting you. Retinal scan checks out... you may proceed." "Have a nice day." It's been a while since I posted something... it's good to be back! C&C welcome, as always.
-
Location: E11 - The Fascini Cluster Tags: Spaceship, Civil Building Dramatis Personae: Previously: http://www.eurobrick...howtopic=136564 Currently, in the Fascini Cluster... Sir, what are we doing out here in the Fascini Cluster? Shouldn't you be preparing some sort of public response to the death of Kawashita's Agent Raven? Speaking of which, you've been silent on the death of John Hannibal. I know he was a good friend of yours. John understood that the now is more important than the then. We will mourn his passing when the then is now. What? Same with Agent Raven. The then is then right now. And speaking of right now, we have a unique opportunity to help our recently returned Dr. Long. She has been gathering many scientists for a very important project. So we're here to help Dr. Long, then? <sigh> No, Eshey. Pay attention. We are here to help her now. Helping her then would be too late. Anyways, I have invited a renown intergalactic astrogeneticist to join her efforts. He agreed and asked us to meet him here. In fact, his shuttle just docked with us. Then he's just arrived? No, Eshey. <sigh> He's arriving now. Welcome aboard, Doctor. Dr. Gene Hackman, this is my associate, Eshey Kolai. Eshey, this is renown astrogeneticist, Dr. Gene Hackman. HOLY AVOCADOS!!! HE'S AN ALIEN!!! KILL HIM KILL HIM!!! [ <sigh> My sincere apologies, Dr. Hackman. My associate is obviously having some sort of meltdown. TACGGAACTACTGGGATACA. GGGAACATACTATCATTTAGAC. CATTAGGAACATAGAAGATTCAGACAGTACCGCTGAATAGCA. ACATAGCGATTACATGACGATGACTATGCATACG. CGAGATTTACGTATAGCAGTACATAGACTGCGCAGATGA. You think maybe this is some sort of inherited genetic condition and you'd like to examine her? AGTCGACTACTGGGATAAAGACGACA. GGCAGGGACTATACGAACATACTATACCTATATTGAG. GGCATATCGTTAGGAACAGTTACATTCAGACAGTACCAGACTTAGGACGA. GACTTAGCACTATGGAC. AGCTTTTTAGCTATACGAATGATG. It would be an honor to have you experiment on my associate. Comments and criticisms are all welcome!
-
Location: H06 Farmolis Tags: Land Vehicle Previously... // PERSONAL DIARY // It had been a very busy time of late and I wanted to get out a bit and just relax and have some fun. It was exciting that we'd recently discovered Awesomnium Alloy, but I just wanted to turn off my brain for a little bit. Luckily one of the new prototype racecars was available (helps being an exec!). So I went out to one of our testing facilities outside Farmolis City and took it out for a spin. The robo-engineer gave me the quick overview and checked that all systems were nominal before I headed out. It was great getting to really let it loose and have some time alone. It wasn't that long ago that I wouldn't have been as comfortable in such a high powered vehicle, but I think I've grown a lot since joining Octan! Extra Pics: I even put some lights underneath! See all the photos I took!
-
FARMOLIS CITY, Farmolis (Junali 29, 3816) — The premiere corporation in Andromeda's Gates is pleased to announce an exciting scientific advancement in the usage of Awesomnium. Thanks to the hard work of all Octan employees and robotic assistants the Octan corporation has made a technological breakthrough in the usage of Awesomnium by creating a new Awesomnium alloy. This fantastic metal will decrease weight, increase energy efficiency and greatly improve the daily lives of humanity! The fantastic new alloy allows for vast increases in tensile strength at a tremendous weight savings, enabling thinner metal that is as strong or stronger than current alloys. The great scientists for Octan were able to make this stunning progress through the discipline of their leadership and vision of their stellar employees. Like everything that Octan does, this achievement has to be seen as a victory for humankind. For those interested in helping Octan continue to better the lives of people daily, please click here! About Octan The glorious Octan corporation has been in existence for as long as Legokind has needed power. Everything from oil to batteries, through to giant space-station powering supra-photonic-awesomnium generators, Octan has you covered.
-
Location: H06 - Farmolis Tags: Civilian Building Dramatis Personae: Previously: http://www.eurobrick...howtopic=134882 Currently, on Farmolis... Where are you calling me from, Shaniqua? Alan Bobby Johnny and I are currently back in old Japan on old Earth. He was pretty depressed after FAPPIE left him, so I decided to cheer him up by taking him on a vacation to old Taiwan and Japan. That's very thoughtful. Here, let me send you some videos of our trip. <incoming video files> +++++++++++++++++++++++++++++++++ WHOA!!! YOU MEAN AS PART OF THE TOUR PACKAGE, WE GET TO RIDE IN THESE VINTAGE AIRPLANES AS PART OF OUR VACATION EXPERIENCE?!?!?! AWESOME!!! That's right, darling. A spaceship would have been faster, but we are doing the whole classic experience thing. THAT'S OKAY, BABY!!! THERE'S NO SCHOOL LIKE THE OLD SCHOOL!!! +++++++++++++++++++++++++++++++++ HEY, BABY!!! LET ME SHOW YOU SOMETHING TALL AND ERECT!!! CHECK IT OUT!!! IT'S TAIPEI 101!!! Yes it is, darling. Yes it is. +++++++++++++++++++++++++++++++++ AND LIKE MY TOWER OF POWER, TAIPEI 101 ALSO LIGHTS UP AT NIGHT!!! Why don't we go back inside so you can show me your tower of power, darling? YOU GOT IT, BABY!!! +++++++++++++++++++++++++++++++++ HEY, BABY!!! YOU CAN FIND CHEAP EMPLOYEES FOR KAWASHITA HERE!!! No. Unlike those losers at Octan, we won't hire knockoffs. At Kawashita, we have standards. +++++++++++++++++++++++++++++++++ Darling, this is Iga-Ueno Castle in the city of Iga, one of the original homes of the ninja. DON'T YOU MEAN WINJA, BABY?!?!?! BECAUSE THEY ALWAYS WIN!!! LIKE ME!!! Yes, darling, winjas. +++++++++++++++++++++++++++++++++ OH OH OH!!! AREN'T YOU WEARING ONE OF THOSE THINGS?!?!?! TAKE A PICTURE WITH IT!!! Well, darling...this one isn't rated for space combat like mine is. +++++++++++++++++++++++++++++++++ WHOA!!! ANOTHER CASTLE!!! Yes, darling. This is Nijo Castle, which was originally built to protect the imperial palace in Kyoto. +++++++++++++++++++++++++++++++++ LOOK, BABY!!! IT'S A LEGO KYOTO STATION INSIDE THE REAL KYOTO STATION!!! IT'S HUGE AND FULL OF WIN!!! LIKE ME!!! Yes, darling. +++++++++++++++++++++++++++++++++ Darling, these are the famous red torri gates at the Fushimi Inari Shrine. THEY GO ON FOREVER!!! LIKE ME!!! Yes, darling. +++++++++++++++++++++++++++++++++ <end video files> Comments and criticisms are all welcome!
-
Location: H06 - Farmolis Tags: Land Vehicle Dramatis Personae: Previously: http://www.eurobrick...howtopic=135847 Currently, on Farmolis... Bruce is going to do what?!?!?! Bruce is going to test pilot his new open cockpit jetfighter design. It's a motorcycle!!! There you go with your usual nonsense, Eshey. It's not a motorcycle. IT IS A MOTORCYCLE AND HE'S GOING TO DRIVE IT OFF A CLIFF!!! I appreciate your concern, Ms. Kolai, but I'm pretty confident about this one! See you back at headquarters. Drinks are on me! But, wait... Here I go! Comments and criticisms are all welcome!
-
Location: H06 Farmolis Tags: Civil Building Previously... // PERSONAL DIARY // I wanted to show our guest Raylan a good time before he had to depart back for Mantis space. They needed him to return to work and though I was sad to see him go, I understood that work has to be a priority. I thought we could have a big sendoff though, so I booked the reception center at the Academy of Sciences and we invited lots of people from Farmolis and beyond. Our friends from the Farr-tes even managed to make their way to the party! Despite the Octan desire to largely have reliable robots perform mundane tasks, I wanted to make sure this party was extra special so I actually had real human waiters! It certainly seemed like everyone had a great time and Raylan especially was grateful for our warm farewell. Extra Pics: ** Happy 1 year of build weeks to AG!!! ** ** I wanted to make this for weeks and finally found the time. The style aesthetic is definitely me and it is very clean. Plus I wanted to have a party to celebrate. ** ** Oh and those SoNE players might recognize a cameo from my player in that game ** I took a lot of pics this week, for all of them you can hit my Flickr stream: https://www.flickr.c...2136@N04/9h6PB3
-
Location: H06 Farmolis Tags: Land Vehicle Previously... // PERSONAL DIARY // Unfortunately, I had to depart Farmolis for The Fascini Cluster an asteroid orbiting Farmolis. However, I left Raylan with Dr. Allison and they decided to go into downtown Farmolis City and enjoy some of the nightlife. We are very lucky to live in a time when people from all different groups can come together and enjoy a fun time out. I was glad that Dr. Allison could take him out for a fun night out so he wouldn't be bored by himself. Meanwhile I had headed out to inspect one of our latest research/monitoring stations on one of the larger asteroids in The Fascini Cluster orbiting Farmolis. I used one of the little service vehicles aboard the ship that took me out to the asteroid field to reach the location. It wasn't very big, but the information we obtain from stations like this one help us refine our Awesomnium location and collection process. And if there is one thing Dr. Long espouses it is efficiency! **Not trying to get too political, just figured I could work in something from real world into my storyline ** Extra Pics:
-
Tags: Civil, Buildings Planet: Farmolis Atlas Shrugged by Danny-Longlegs, on Flickr Dr. Long: "Funny seeing you here, Amaira, I was just headed to see you actually. I have an appointment with you at your practice 30 minutes from now." Doctor Patel: "Ah, Hello Danielle. I'm on my lunch break. The gardens are beautiful on South Main Street, wouldn't you agree?" Dr. Long: "Yes, Amaira, they are indeed beautiful. Specimens from Earth, all of them. They grow so verdant on this world of ours." Dr. Patel: "Indeed." Dr. Long: "Of course, they grow so well because we modified them to do so... just as we've modified this planet." Dr. Patel: "Indeed." Dr. Long: "..." Atlas Shrugged by Danny-Longlegs, on Flickr Dr. Patel: "So, how are you feeling, Danielle. Last we spoke you were furious at me, if I recall." Dr. Long: "That's an exaggeration. Frustrated, would be more accurate. Frustrated that you wouldn't allow me to return to my duties aboard the Axle." Dr. Patel: "Of course. You're so much like your mother, Danielle. So passionate for your work... Devoted. And stubborn. You must take better care of yourself, Danielle. The reason I didn't let you go back so soon was--" Dr. Long: "--I know--" Dr. Patel: "Your muscular atrophy has diminished, thanks to your regular exercise and consistent Gravity, but your bone density will never recover, Danielle." Dr. Long: "I take my supplements, my estrogen, my OctaOsteo. I spend the requisite amount of time on the G+ decks on the Axle... And I've looked over the paperwork, Amaira. My bone mass has not decreased at un-expected levels. It's completely standard for my job description." Dr. Patel: "Then perhaps it's your job description that needs to change." Dr. Long: "You know that's not going to happen." Atlas Shrugged by Danny-Longlegs, on Flickr Dr. Patel: "I know... But you're damaging your body being in space so regularly. You must take care of your body, or it may break." Dr. Long: "Then I'll buy a new one." Dr. Patel: "I care about you. I loved your mother dearly, and I just don't want you to make the same mistakes she did." Atlas Shrugged by Danny-Longlegs, on Flickr Dr. Long: "..." Dr. Patel: "I won't change your mind." Dr. Long: "No." Dr. Patel: "When we meet again thirty minutes from now... I'm going to sign off on your request to return to work." Dr. Long: "Thank you. It's what I want." Dr. Patel: "I know. I won't delay you longer, then." Dr. Long: "... Thanks." Dr. Patel: "Oh, I read your books by the way. "The Modern Darwins" Is a bit too coldly worded for an informal piece, I think. You should lighten up. Good for your heart." Dr. Long: "I'll see you soon." Atlas Shrugged by Danny-Longlegs, on Flickr Atlas Shrugged by Danny-Longlegs, on Flickr Atlas Shrugged by Danny-Longlegs, on Flickr This statue depicts John Hannibal as Atlas. One of the many statues of him that adorn the streets of Farmolis Headquarters city, now. He was perhaps the most efficient CEO we've had on the Andromeda Branch, which I found quite admirable. I could fault the man for very few things. Perhaps he was a little soft-hearted on the Alien species with whom he made contact... but that line of thought brought the Merchant Confederation within our folds. Perhaps the only thing I could truly fault him for was his humility. At times he shouldered more of the logistical burdens of running Octan than the next three people put together... myself included. And for all his work he requested no thanks. Needed no other incentive than loyalty to our great company. A giant among men, was he... so perhaps he would have liked this statue. He once told me, "A Gentleman wears white." What could be more white than pure marble?" Atlas Shrugged by Danny-Longlegs, on Flickr Atlas Shrugged by Danny-Longlegs, on Flickr "If my memory serves, I think he believed in some higher power. A life after death. I do not. What is dead is dead. A sentience, once snuffed out returns to the void that bore it. The only form of life after death that I am aware of, from my studies, and introspection, is that which lives on in others. In those with whom you interacted, and those who have heard of you. So whether or not, John Hannibal lives on in some incomprehensible spiritual form, he most assuredly lives on in the scorch marks he left on this galaxy... and in the stones of his statues. These... more... abstract definitions of life... certainly not a life as a biologist such as myself would describe it... but, these forms of life outlive us all. Our legacy..." Atlas Shrugged by Danny-Longlegs, on Flickr ........................... Hours later, in a different part of the city.... Kevin: "Danny! Wonderful to see you again! I heard from your doctor that you'll be returning to work on the Axle! That's just great!" Dr. Long: "Mhhmm. I won't even ask how you found out so quickly." Kevin: "There's my Danny! Always not-asking the right not-questions!" Dr. Long: "So... To what do I owe the pleasure of an appointment with you." Kevin: "Well, I thought you and I might have a little chat!" Dr. Long: "A chat." Kevin: "Well yeah! About... your career goals." Dr. Long: "What about my career goals." Kevin: "well, I guess I'll just cut to the chase. Do you want to be back on the board of the executives?" Dr. Long: "Of course." Kevin: "That's just what I wanted to hear! So... Exactly how badly do you want it?...." __________________________ Better pictures in the morning. Critiques and comments welcome! For Rodiziorobs: Atlas Shrugged by Danny-Longlegs, on Flickr ~Insectoid Aristocrat
-
Location: H06 - Farmolis Tags: Spaceship Dramatis Personae: Previously: http://www.eurobrick...howtopic=134086 Currently, on Farmolis... FAPPIE! WHAT ARE WE DOING HERE ON FARMOLIS?!?!?! FAPPIE tired of playing "joystick" with Master. FAPPIE leaving Master to join racing circuit. NO FAPPIE!!! PLEASE COME BACK!!! Comments and criticisms are all welcome!
-
Planet: Marphacia - B05 Tags: Military, Building. Chapter 2: Uplink. Yseult stood on the upper terrace on the eastern side of the M.A.N.T.I.S. outpost watching the Marphacene sunrise. As usual, the morning mists diffused it into a messy and unattractive blur that was far too bright for her liking but she hadn't been able to sleep again, so she watched it anyway. Why am I here, she pondered, considering the unusual events that had led to her being wrapped up in the Galaxy's 'most avoided' mega-coporation. She didn't trust them, but then they probably didn't trust her either... except maybe for that scientist... Why an I here Big Sal? Why did you bring me in? "Late finish or early start?" The voice behind her came from a man carrying two steaming mugs, one of which he offered her. "Either way" he continued, raising his eyebrows to emphasise the offer, and perhaps intonate that there is wisdom in having the drink. "Coffee?" Yseult asked, taking it with both hands, the warmth welcoming against the brisk early morning air. The man let out a wry smile. "I wish" he responded. "Why pay to ship in coffee once they discovered you could get twice the caffeine from locally grown delicious cold-steeped brooga beans. Just add..." He looked, down at his mug with a worried expression. "Well, anything that'll take the taste away". Yseult couldn't stop a brief smile and an ever more brief chuckle. She looked at her feet as if to hide her face in embarrassment; it had been a long time since anyone had made her laugh. The man carried the smile he had from evoking the reaction openly. "And there was everyone telling me the new girl was just a walking bad temper." He said, holding his mug forward. That's because I am she thought. She considered the gesture, Friendship her heart implored. You can't trust him her head warned. Warily, she raised her mug and they chinked with a dull thud. "Riddaeon" He said before taking a large gulp of the brew. Yseult stopped, perhaps she'd hoped she'd never have to tell him, she'd prefer not to. It was an instinct, she was safer if no one knew who she was, that was how it had been for five years now. That's how I survive. "Yseult" she finally said, as quietly as she could get away with before taking a long sip of the drink herself. She didn't mind the bitterness so much as the flavour of something trying to be a tart fruit and a herb at the same time. She lowered the mug and couldn't hold back the grimace of displeasure but upon seeing Riddaeon's similar reaction, they both found some comedy in sharing such an unpleasant experience. "It's very bad" she was finally able said once the taste has stopped forcing her mouth into a painfully tight sliver. The moment was broken by the sound of an approaching shuttle as it flew directly overhead and disappeared at the peak of the pyramid-like structure that formed the outpost. 'Uplink' was a communications hub, its landing bays arranged vertically down the centre of the North and South faces with smooth walls of opaque and transparent composites on either side. The East and West faces were not so elegant, one having a huge dish for off-world communications and data transfer (the function that gave the outpost its name) and the other having the communal block and local transceiver antenna. At the top of the pyramid, 360 degree views were afforded to traffic control and the executive's offices, above which was their private landing pad. with regular traffic all being directed to approach the main landing bays from the North or South, a shuttle arriving from the West into the peak of the structure could only mean one thing... Someone important had arrived. Once the shuttle was out of view, Riddaeon looked back to Yseult. "Looks like news of your arrival is spreading" He said. She looked back at him, did he expect an answer? Did he think she knew who was in the shuttle? "I've seen people come and go in M.A.N.T.I.S." He continued. "I know what kind of people they are, what they look like". He paused for a moment, as if trying to figure out the answer to a question he hadn't asked yet. "They don't look like you." A tension emerged between them. Yseult knew M.A.N.T.I.S. operatives were supposed to be suspicious types, always looking for spies. Was she accused? Suspected? He took a last gulp of his despicable coffee and inspected the dregs at the bottom of the mug. "Why are you here... Yseult Brenneux?" He gave her one last look, then casually strolled back towards the building entrance. "I didn't tell you my full name" she call after him. He stopped, gently placed his mug on a nearby table. "No." he replied with certainty. "You didn't". He gave her one last glance, then turned and continued to the doors back inside. He's trying to read me she told herself, or scare me. She didn't like either. Uncertainty clutched at her. Where am I? Why am I here?. Would she ever get back to her normal life? But I don't want to go back. I didn't choose that life, they left me there. She was tired of looking back though, M.A.N.T.I.S. was a strange place but look what it offered. But if I leave, I'll never find her... I'll never get her back. Chapter 1: The mark Additional images:
