pombe

Not enough bricks in your corporation's colors? NEVER FEAR!!! Check it out what my crew has done: an entry with just terrain an entry with Kawashita colors we be pirates in this entry, yar a spaceship made from space whale flesh working with the Merchant Confederacy using M.A.N.T.I.S. vehicles using Kawashita vehicles and a M.A.N.T.I.S. fitness club dealing with the Dust Demons racing with the Separatists

Location: E11 - The Fascini Cluster Tags: Land Vehicle, Exploration Dramatis Personae: Previously: http://www.eurobrick...howtopic=138264 Currently, in the Fascini Cluster... What am I doing on a poop asteroid again?!?! The fact that we found one at all is a major coup, Eshey. Space whales are not as abundant as they used to be, due to illegal space whaling activity. This is our chance to get a lot of rare poop samples for Dr. Long. Holy avocados! There are poops aliens here! I have no weapons!!! Stand down, Eshey! It seems they are trying to communicate. Frrrrrr. Frrrrrrrrrrrrrr. Frrrrr. Frr. Frrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrr. Frrrrrrrrrrrrrrr. Frrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrr. Frrrr. Frrrrrrrrrrrrrrrrrrrrrr. Frrrrrrrrrrrrrrrrrrrrrrrr. You're Lolita and your friend is Chastity, and you're both exotic dancers? Frrr. Frrrrrrrrrrrrrr. Frrrrrrrrrrrrrrrrrrrr. Frrrrrrrrrrrrrr. Frrrrrrrrrrrrrrrr. Frrrr. F. Frrrrrrrrrrrrrrrr. Frrrrrrrrrrrrrrrrr. Frrrrr. Frrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrr. Frrrrrrrrrrrrrrr. Frrrrrrrrrrrrrrrrrrrrrrrrrrrrrr. Frrrrrrrr. And you're inviting us to the gentleman's club on this poop asteroid? No cover charge, two drink minimum? Hold on, I'm taking a shuttle transport right over! Comments and criticisms are all welcome!

This is a wonderful entry! I myself am a huge fan of pocket monsters! Perhaps Octan should dedicate some resources in R&D to produce all sorts of pocket monsters! I'll get Kodan on it at once! Great idea, sir! The galaxy could definitely use a lot more pocket monsters.

TK-8554 has been initiated into Razer Squad.

Personnel Files: Currently, on Tatooine... I'm innocent, you Imperial goons! I have no idea what you are talking about! We've intercepted transmissions from your home detailing Imperial patrol movements in your neighborhood. While we don't know exactly who the intended recipients of these transmissions are, we do know the only reason why someone would send them is to help the Rebellion organize against us. It wasn't me! I've been framed! We'll let the interrogation droid determine that. TK-8554, hold on. Sir? See, see?! Listen to your commander! She knows I'm telling the truth! It's time for your initiation. Heh. Initiation? What's going to happen is that this Rebel sympathizer scum is going to resist arrest. And in the ensuing struggle, you are going to put a blaster bolt through him. Then we will leave his decrepit corpse here to desiccate and mummify as a warning to others who might think of betraying the Empire. And in my report, I will state how well you handled your first assignment. Wait...I'm just an old man! You can't do this! YOU FIEND! <pew> Congratulations, "Fiend". And welcome to Razer Squad. All comments and criticisms welcome!

Dramatis Personae: Thank you, Sue and Eshey, for joining me as I inspect one of Octan's entries into the mech wrestling competition for the 2016 Space Olympic Games here in Andromeda. Glad to be here, sir. Thanks for inviting me. I'm just happy that the corporations in Andromeda are trying to improve their relations. So, sir, what is our strategy for this entry? Everyone thinks that wrestling is about physical strength and technique. Isn't it, sir? That's what small minds think, Eshey. However, this entry will win by completely outsmarting its opponents. Meet Octan's big head wrestling mech! What in the av...the av...av...oh my.... Something wrong, Eshey? I...I don't believe it. I've run out of avocados to give. That sounds like something you should have looked at. It comes equipped with a giant neuroprocessor made up of 1 billion parallel quantum processors capable of handling up to 500 exabytes of information every 100th of a second. Impressive. It comes with three personalities to allow it to adapt to different situations quickly, each represented by a different face. This also offers the mech 360 degree vision, meaning that no opponents can ever sneak up on it. It can be its own friend and form its own clique. It also comes equipped with a timer and headlamps for wrestling in the dark. That's my favorite kind of wrestling. This mech is just a giant head! How can it wrestle? Sigh. By outsmarting its opponents. Don't you listen, Eshey? What about physical attributes?! Don't you ever play any role playing games, Eshey? You only have so many points to allocate for stats. In this case, all the points were put into Intelligence. No one ever creates a well-rounded role playing character. How is it supposed to wrestle with such tiny arms?! You know who else had tiny arms, but dominated its opponents, Eshey? Tyrannosaurus Rex. I think it's pretty clear that this mech will be as powerful and dominating as Tyrannosaurus Rex. Comments and criticisms are all welcome!

All my monies to Bob!

Location: E11 - The Fascini Cluster Tags: Land Vehicle Dramatis Personae: Previously: http://www.eurobrick...howtopic=137986 Currently, in the Fascini Cluster... Thanks for field testing our latest vehicle, Eshey. What in the avocado is this?!?! It's Octan's latest artillery mech. I call it the Compensator. It's all sorts of wrong! Hmm? I thought you liked firepower. Comments and criticisms are all welcome!

All my monies to Bob!

Location: E11 - The Fascini Cluster Tags: Land Vehicle Dramatis Personae: Previously: http://www.eurobrick...howtopic=137678 Currently, in the Fascini Cluster... Hello? Can anybody hear me? I say, this is embarrassing. Is anybody out there? Drinks for whoever responds! Anybody? Comments and criticisms are all welcome!

All my monies to Bob!

Location: E11 - The Fascini Cluster Tags: Land Vehicle, Spaceship Dramatis Personae: Previously: http://www.eurobrick...howtopic=136916 Currently, in the Fascini Cluster... Scanning the asteroids for awesomnium now, sir. We're doing an actual assignment?! This one seems to be promising. Then set her down. It's not a poop asteroid, is it?! We've landed, sir. Where are the aliens that come out of no where with normal names and strange occupations, speaking things that only I don't understand?! Lower the ramp, Sue. Beginning my survey. There's no poop, innuendo, or bad science?! What's going on?! Comments and criticisms are all welcome!

Location: E11 - The Fascini Cluster Tags: Land Vehicle, Civil Building Dramatis Personae: Previously: http://www.eurobrick...howtopic=136916 Currently, in the Fascini Cluster... Eshey, since I'm currently away attending the annual Brick Fiesta convention, would you mind checking on the progress in the engineering bay? Sure, I'll head on over, sir. Oh avocados...what are you guys doing in the engineering bay? Dr. Gene Hackman was helping me develop Octan's latest patrol starship. I'm buying drinks afterwards. You're welcome to join, of course. No one will believe me when I say that the vehicle is a segway and not a starship, will they? Of course, it's a starship, Eshey. How does that even look like a segway? What?! There's a viewscreen in the engineering bay! Why did you even send me down here if you could just access the view screen in the engineering bay and see for yourself? Because, Eshey, I'm not there. I'm busy at Brick Fiesta. WHAT?! YOU'RE LOOKING AT IT RIGHT NOW!!! Hold on. Wait. Why is Dr. Hackman, an astrogeneticist, working on a seg...er...a patrol starship? Shouldn't he be helping Dr. Long with her project? Oh, Dr. Long is busy meeting with royalty of some sort. You know, part of being a famous Octan scientist and all. I figured that since now is then, we could take advantage of Dr. Hackman now. I don't follow...er...let me phrase this differently...when does then become now? Later. What? In any case, Dr. Hackman is adding DNA to our starship prototype. Afterall, if our starships had DNA in them, we wouldn't have to manufacture them anymore. They could simply breed and reproduce, reducing our overhead costs. Comments and criticisms are all welcome!

All my monies to Bob!

Location: E11 - The Fascini Cluster Tags: Spaceship, Civil Building Dramatis Personae: Previously: http://www.eurobrick...howtopic=136564 Currently, in the Fascini Cluster... Sir, what are we doing out here in the Fascini Cluster? Shouldn't you be preparing some sort of public response to the death of Kawashita's Agent Raven? Speaking of which, you've been silent on the death of John Hannibal. I know he was a good friend of yours. John understood that the now is more important than the then. We will mourn his passing when the then is now. What? Same with Agent Raven. The then is then right now. And speaking of right now, we have a unique opportunity to help our recently returned Dr. Long. She has been gathering many scientists for a very important project. So we're here to help Dr. Long, then? <sigh> No, Eshey. Pay attention. We are here to help her now. Helping her then would be too late. Anyways, I have invited a renown intergalactic astrogeneticist to join her efforts. He agreed and asked us to meet him here. In fact, his shuttle just docked with us. Then he's just arrived? No, Eshey. <sigh> He's arriving now. Welcome aboard, Doctor. Dr. Gene Hackman, this is my associate, Eshey Kolai. Eshey, this is renown astrogeneticist, Dr. Gene Hackman. HOLY AVOCADOS!!! HE'S AN ALIEN!!! KILL HIM KILL HIM!!! [ <sigh> My sincere apologies, Dr. Hackman. My associate is obviously having some sort of meltdown. TACGGAACTACTGGGATACA. GGGAACATACTATCATTTAGAC. CATTAGGAACATAGAAGATTCAGACAGTACCGCTGAATAGCA. ACATAGCGATTACATGACGATGACTATGCATACG. CGAGATTTACGTATAGCAGTACATAGACTGCGCAGATGA. You think maybe this is some sort of inherited genetic condition and you'd like to examine her? AGTCGACTACTGGGATAAAGACGACA. GGCAGGGACTATACGAACATACTATACCTATATTGAG. GGCATATCGTTAGGAACAGTTACATTCAGACAGTACCAGACTTAGGACGA. GACTTAGCACTATGGAC. AGCTTTTTAGCTATACGAATGATG. It would be an honor to have you experiment on my associate. Comments and criticisms are all welcome!

All my monies to Bob!

[sR - Ch3A] The truth is out there | pombe | Sea Rats

Dramatis Personae: Previously: http://www.eurobrick...howtopic=132603 Currently, on an uncharted island... My calculations were correct. Here it is. What is it? This, Wilhem...ahem...Willy, is the legendary Fountain of Youth. I thought it was just a myth. From my research, I've learned that it is very much real. However, it's not of much use now, since it appears to no longer function. FOUNTAIN'T!!! I do find the statue in the fountain curious. Perhaps it was some sort of god or higher being? Whatever it is, it does look out of this world. Oh, stop with the stupid veiled alien references!! There are no aliens in this forum!! And no, this fountain doesn't have some sort of advanced technology to reverse aging that stopped working a long time ago!! Who writes this stuff?!?! That loser should go back to the sci-fi forum where they tolerate this kind of terrible writing!!! All comments and criticisms welcome!

Mom!!! MOM!!!

Location: H06 - Farmolis Tags: Land Vehicle Dramatis Personae: Previously: http://www.eurobrick...howtopic=135847 Currently, on Farmolis... Bruce is going to do what?!?!?! Bruce is going to test pilot his new open cockpit jetfighter design. It's a motorcycle!!! There you go with your usual nonsense, Eshey. It's not a motorcycle. IT IS A MOTORCYCLE AND HE'S GOING TO DRIVE IT OFF A CLIFF!!! I appreciate your concern, Ms. Kolai, but I'm pretty confident about this one! See you back at headquarters. Drinks are on me! But, wait... Here I go! Comments and criticisms are all welcome!

All my monies to Bob!

Big Z has a wife and child? That's okay, honey. You have me!

Location: H06 - Farmolis Tags: Civilian Building Dramatis Personae: Previously: http://www.eurobrick...howtopic=134882 Currently, on Farmolis... Where are you calling me from, Shaniqua? Alan Bobby Johnny and I are currently back in old Japan on old Earth. He was pretty depressed after FAPPIE left him, so I decided to cheer him up by taking him on a vacation to old Taiwan and Japan. That's very thoughtful. Here, let me send you some videos of our trip. <incoming video files> +++++++++++++++++++++++++++++++++ WHOA!!! YOU MEAN AS PART OF THE TOUR PACKAGE, WE GET TO RIDE IN THESE VINTAGE AIRPLANES AS PART OF OUR VACATION EXPERIENCE?!?!?! AWESOME!!! That's right, darling. A spaceship would have been faster, but we are doing the whole classic experience thing. THAT'S OKAY, BABY!!! THERE'S NO SCHOOL LIKE THE OLD SCHOOL!!! +++++++++++++++++++++++++++++++++ HEY, BABY!!! LET ME SHOW YOU SOMETHING TALL AND ERECT!!! CHECK IT OUT!!! IT'S TAIPEI 101!!! Yes it is, darling. Yes it is. +++++++++++++++++++++++++++++++++ AND LIKE MY TOWER OF POWER, TAIPEI 101 ALSO LIGHTS UP AT NIGHT!!! Why don't we go back inside so you can show me your tower of power, darling? YOU GOT IT, BABY!!! +++++++++++++++++++++++++++++++++ HEY, BABY!!! YOU CAN FIND CHEAP EMPLOYEES FOR KAWASHITA HERE!!! No. Unlike those losers at Octan, we won't hire knockoffs. At Kawashita, we have standards. +++++++++++++++++++++++++++++++++ Darling, this is Iga-Ueno Castle in the city of Iga, one of the original homes of the ninja. DON'T YOU MEAN WINJA, BABY?!?!?! BECAUSE THEY ALWAYS WIN!!! LIKE ME!!! Yes, darling, winjas. +++++++++++++++++++++++++++++++++ OH OH OH!!! AREN'T YOU WEARING ONE OF THOSE THINGS?!?!?! TAKE A PICTURE WITH IT!!! Well, darling...this one isn't rated for space combat like mine is. +++++++++++++++++++++++++++++++++ WHOA!!! ANOTHER CASTLE!!! Yes, darling. This is Nijo Castle, which was originally built to protect the imperial palace in Kyoto. +++++++++++++++++++++++++++++++++ LOOK, BABY!!! IT'S A LEGO KYOTO STATION INSIDE THE REAL KYOTO STATION!!! IT'S HUGE AND FULL OF WIN!!! LIKE ME!!! Yes, darling. +++++++++++++++++++++++++++++++++ Darling, these are the famous red torri gates at the Fushimi Inari Shrine. THEY GO ON FOREVER!!! LIKE ME!!! Yes, darling. +++++++++++++++++++++++++++++++++ <end video files> Comments and criticisms are all welcome!

All my monies to Bob!