Search the Community

Showing results for tags 'OCTAN'.



More search options

  • Search By Tags

    Type tags separated by commas.
  • Search By Author

Content Type


Forums

  • Frontpage, Forum Information and General LEGO Discussion
    • Guest Section - PLEASE READ BEFORE YOU REGISTER!
    • Frontpage News
    • Forum Information and Help
    • General LEGO Discussion
    • The Embassy
  • Themes
    • LEGO Licensed
    • LEGO Star Wars
    • LEGO Historic Themes
    • LEGO Action and Adventure Themes
    • LEGO Pirates
    • LEGO Sci-Fi
    • LEGO Town
    • LEGO Train Tech
    • LEGO Technic and Model Team
    • LEGO Mindstorms and Robotics
    • LEGO Scale Modeling
    • LEGO Action Figures
    • Special LEGO Themes
  • Special Interests
    • Minifig Customisation Workshop
    • LEGO Digital Designer and other digital tools
    • Brick Flicks & Comics
    • LEGO Mafia and Role-Play Games
    • LEGO Media and Gaming
  • Eurobricks Community
    • Hello! My name is...
    • LEGO Events and User Groups
    • Buy, Sell, Trade and Finds
    • Community
    • Culture & Multimedia

Find results in...

Find results that contain...


Date Created

  • Start

    End


Last Updated

  • Start

    End


Filter by number of...

Joined

  • Start

    End


Group


What is favorite LEGO theme? (we need this info to prevent spam)


Which LEGO set did you recently purchase or build?


AIM


MSN


Website URL


ICQ


Yahoo


Jabber


Skype


Location


Interests


Country


Special Tags 1


Special Tags 2


Special Tags 3


Special Tags 4


Special Tags 5


Special Tags 6


Country flag

Found 522 results

  1. Dannylonglegs

    [Challenge 5][Cat A] Lil' Longlegs

    On Farmolis's Famous Octan Olympic Arena, where all the best and brightest athletes have come to train! Including none other than Dr. Danielle Long, who was surprised to wake up to a holo-mail from CEO Pombe, requesting her presence at the games... on penalty of forfeiture of shares... Octan Olympics! by Danny-Longlegs, on Flickr Engineer: "Well, madam, as you can see, the core and engine are fully functional. She's operating at 95% Target output." Dr. Long: "Hmm... That's unacceptable. Tighten that nozzle, adjust the location of that fuel pump, and reconfigure the wiring. Bring it up to 100% Target Output, or I will find someone who can." Engineer: "If only... Triple H were here..." Dr. Long: "He is not here. Do what must be done." Octan Olympics! by Danny-Longlegs, on Flickr Dr. Long: "Why are these not assembled? Engineer: "Well, you see, there's a real funny story about that..." Dr. Long: "I did not come here to listen to funny stories. I came here to assess your craftsmanship, and right now, I'd say it's certainly lacking." Engineer: "I'm waiting on Pneumatics to supply me with the gas repressurizer! I can't do final assembly until they get me that pressurizer!" Dr. Long: "Stop looking for excuses. I'll deal with Pneumatics... And as for you... pack your things. I'll add finding a suitable replacement to my agenda. That shouldn't be too hard, I don't think." Engineer: "No, please! I've got a wife and three kids!" Dr. Long: "No you don't. In your file it says you're "Single and ready to mingle." Engineer: "Well, I want a wife and three kids eventually..." Dr. Long: "Get out." Octan Olympics! by Danny-Longlegs, on Flickr Dr. Long: "And what seems to be the holdup here!" Software Specialist: "I'm giving her all she's got, Doctor, but I can't access tha damn file to download!" Dr. Long: "Honestly, the incompetence I have to put up with on a daily basis. Clappy, access file Zoology_AI_Bullfrog.exe. This is Doctor Long, code blue entry, pass 98765. "You got it, boss!" Dr. Long: "Finally, someone who follows my orders." Later...... Octan Olympics! by Danny-Longlegs, on Flickr "Finally, I have my competition entry assembled. When I designed these schematics, I modeled her after the robots I use to collect samples underwater... and then I gave her legs because that was an entry requirement. Honestly I just want to get this over with so that I can continue doing science, but perhaps I can bring glory to the great Octan Corporation by performing above average in this contest. After all, I am a perfectionist. No one will stand my way when I set my mind to something. Now, Let's get this baby started. Lil' Longlegs, please initiate Start Sequence." Octan Olympics! by Danny-Longlegs, on Flickr "Perfect." About the Mech: In professional Mech Wrestling contests, Mechs of this nature (long legs, hunched torso) are frowned upon, but not outruled. Typically they are seen used by "Heel" Performers, as their use is considered... underhanded. The long legs are seen as an unfair advantage, since they add to the balance and leverage of the robot when wrestling... but as they say, the higher they stand, the harder they fall... Dr. Long knows none of this, though, as she only read the exact rules, and has never actually watched or participated in a mech contest. She didn't think to overview any of the ... unspoken rules... after all. Rules are made to be spoken. That said, Dr. Long wouldn't particularly care if she found out. If it's in the rules, it's legal, and if it gives her an advantage, well... too bad. Octan Olympics! by Danny-Longlegs, on Flickr Octan Olympics! by Danny-Longlegs, on Flickr Octan Olympics! by Danny-Longlegs, on Flickr Octan Olympics! by Danny-Longlegs, on Flickr Dat bumper tho'... ____________________________ Notes: Credit for story idea to Bob... ~Insectoid Aristocrat
  2. "Introducing: The Wrestler" "Build by Zaael when he was a kid to bully back the bullies. More than succesful at that... *ahem*, Zaael and The Wrestler entered the underground wrestling circuit back on Earth at the age of 12. His parents didn't approve, Zaael didn't care, they weren't around much anyway!" "Now this lean, mean fighting machine enters the Space Olympics and oh boy! His opponents should be afraid, I know Zaael's bullies were... *ahem*." Size limit: More pics:
  3. Kodan Black

    [O - H04] The Lab - Pt2

    Location: H04 Crofter's Ridge Tags: Civil Building Previously... // PERSONAL DIARY // As we moved into the lab itself I was struck by the fact that I had no idea what anything in here was or did. It looked very advanced, but like nothing I had seen before. I couldn't tell if it was alien or something we had come up with that was very advanced. And there was none of the usual machinery noise, it was so silent. Punctuated further by the lack of people other than our team. Although I did notice what appeared to be an observation room with double heavy armored glass and atomic level filtering. That observation room would keep even these soldiers out for a while and be able to fully filter anything we might use on it at the same time. But why would a lab need that level of security? The team was on alert and seemed pretty worried and edgy. I did my best not to let on that this was all completely unknown to me and that I had no idea if an errant shot would take out half the planet or release something toxic. It kept ringing in my head that no one was here, and that seemed the most out of place. Even if there were no people, being an Octan lab I would have expected robots and droids doing work, but there was nothing. The Major said we should keep going ahead to the elevator and see what was in the sub-levels. As much as I just wanted to get out of there my scientific curiosity kept me going. I also hoped that the lack of anyone or anything would continue, as the alternative seemed much scarier. Extra Pics: All the pics: https://www.flickr.c...4/shares/7Bf6tb
  4. Professor Thaum

    [O - G02] Radar testing

    PREVIOUSLY : Intro Radar : test 1 The Base 1 The Lab 1 LOCATION : Freegate G02 Tags : Science, land vehicle, Octan, Alien : You're OK Hadvice ? : Yes I am professor : Cold Feet Mission Control Center, You're ready ? M.C.C. : Yes professor, you have the satellite link toward the A².N.T. all in passive detection, we are ready : Fine, Hadvice, It's all up to you. Hadvice : Then... Here we go ! The ice Jet works really good, very easy to handle, professor : We don't give a damn of the jet Hadvice ! How does the radar works ? It's all good professor, the radar works properly, I have nothing left on the scope but it works... : Good, keep going. Hadvice : Ah ! The radar locked something... but it seems moving... : Moving ??? It's a Mithril aligned scope ! A².N.T. report please ! A².N.T. : moving object confirmed professor, no further information cause we're in passive mode, but seems biological. : OK, thanks, that's no problem Hadvice, keep going, all's safe. Hadvice : errrr... safe ??? Hadvice : AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAH Professoooooooooooooooooor !! It's really biiiiig !! : You're a bonehead Hadvice !! It's only a little biological bug !! Hadvice : IT'S CHASING MEEEEEEEEEEEEEEEEEEEEEEEEE !!!! HEEEEEEEELP !!! : The Mithril radar Hadvice !!! Keep concentrate on the Mithril radar !!! Hadvice : AAAAAH !!! HEEEEEEEEEEEEELP !!! PROFESSOR !!! A².N.T. !!!! ANYBODY !!!! HEEEEEEEEEEEEEEELP !!!! C&C welcome Bonus pics tomorrow, the MCC and the A².N.T. are Bob's pics and are not to be judged
  5. pombe

    [O - E11] Poop Strippers

    Location: E11 - The Fascini Cluster Tags: Land Vehicle, Exploration Dramatis Personae: Previously: http://www.eurobrick...howtopic=138264 Currently, in the Fascini Cluster... What am I doing on a poop asteroid again?!?! The fact that we found one at all is a major coup, Eshey. Space whales are not as abundant as they used to be, due to illegal space whaling activity. This is our chance to get a lot of rare poop samples for Dr. Long. Holy avocados! There are poops aliens here! I have no weapons!!! Stand down, Eshey! It seems they are trying to communicate. Frrrrrr. Frrrrrrrrrrrrrr. Frrrrr. Frr. Frrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrr. Frrrrrrrrrrrrrrr. Frrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrr. Frrrr. Frrrrrrrrrrrrrrrrrrrrrr. Frrrrrrrrrrrrrrrrrrrrrrrr. You're Lolita and your friend is Chastity, and you're both exotic dancers? Frrr. Frrrrrrrrrrrrrr. Frrrrrrrrrrrrrrrrrrrr. Frrrrrrrrrrrrrr. Frrrrrrrrrrrrrrrr. Frrrr. F. Frrrrrrrrrrrrrrrr. Frrrrrrrrrrrrrrrrr. Frrrrr. Frrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrr. Frrrrrrrrrrrrrrr. Frrrrrrrrrrrrrrrrrrrrrrrrrrrrrr. Frrrrrrrr. And you're inviting us to the gentleman's club on this poop asteroid? No cover charge, two drink minimum? Hold on, I'm taking a shuttle transport right over! Comments and criticisms are all welcome!
  6. Hadvice, you may unplug the model TT Yes professor... done ! Prof : lady and gentlemen, let me introduce yourself... an ancient Octan Sawmill Unit model trimming tool robot ... It was very usefull in a sawmill That's why it will certainly be efficient for your stupid and brutal space game... Just an little upgrade with regard to the first model It is all awesomium powered and has no risk to be out of fuel. It's allright Hadvice, we may leave and let the sportsman deal with it. C&C welcome other bonus pics soon.
  7. Dramatis Personae: Thank you, Sue and Eshey, for joining me as I inspect one of Octan's entries into the mech wrestling competition for the 2016 Space Olympic Games here in Andromeda. Glad to be here, sir. Thanks for inviting me. I'm just happy that the corporations in Andromeda are trying to improve their relations. So, sir, what is our strategy for this entry? Everyone thinks that wrestling is about physical strength and technique. Isn't it, sir? That's what small minds think, Eshey. However, this entry will win by completely outsmarting its opponents. Meet Octan's big head wrestling mech! What in the av...the av...av...oh my.... Something wrong, Eshey? I...I don't believe it. I've run out of avocados to give. That sounds like something you should have looked at. It comes equipped with a giant neuroprocessor made up of 1 billion parallel quantum processors capable of handling up to 500 exabytes of information every 100th of a second. Impressive. It comes with three personalities to allow it to adapt to different situations quickly, each represented by a different face. This also offers the mech 360 degree vision, meaning that no opponents can ever sneak up on it. It can be its own friend and form its own clique. It also comes equipped with a timer and headlamps for wrestling in the dark. That's my favorite kind of wrestling. This mech is just a giant head! How can it wrestle? Sigh. By outsmarting its opponents. Don't you listen, Eshey? What about physical attributes?! Don't you ever play any role playing games, Eshey? You only have so many points to allocate for stats. In this case, all the points were put into Intelligence. No one ever creates a well-rounded role playing character. How is it supposed to wrestle with such tiny arms?! You know who else had tiny arms, but dominated its opponents, Eshey? Tyrannosaurus Rex. I think it's pretty clear that this mech will be as powerful and dominating as Tyrannosaurus Rex. Comments and criticisms are all welcome!
  8. badchriss

    [MOC] Racing Service Van

    Finished my newest MOC: The Racing Van This MOC started as a regular plain Van with a vintage Design but turned into a Service Car for a Racing Team. The Design is influenced by various classic Vans and doesn`t depict a certain Model. The Roofrack is filled with Spare Rims, a Battery and two Boxes filled with all sorts of Spareparts. The Inside has enough Room for a whole Toolshed but at least it Houses the nessesary Tools to keep the Teams Racing Cars running.. Hope you like my newest MOC and feel free to leave a Comment or two
  9. Planet: H04 Crofter's Ridge Tags: Fleet Bonus, Civil, H04, Octan It has been months since with last touch base with JS Smith and his engineering crew, in that time JS has been set on a task to find a vane of awesomnium to get a new minning out post set up for the company...but has not returned, and all communication has seemed to have vanished. A young engineer - Bruno has done some research and has hiked his way to a trial in a mountain trail on Crofter's Ridge in hopes of finding something... IMG_4514 by Meyerj, on Flickr IMG_4506 by Meyerj, on Flickr IMG_4505 by Meyerj, on Flickr IMG_4511 by Meyerj, on Flickr IMG_4510 by Meyerj, on Flickr IMG_4513 by Meyerj, on Flickr IMG_4518 by Meyerj, on Flickr And an orverall view IMG_4504 by Meyerj, on Flickr I have been away for awhile, Real life has been well you know...busy. this is a story arc of bringing back JS Smith..hope you enjoy, more photos on my flicker page, comments always welcome.
  10. pombe

    [O - E11] BFG

    Location: E11 - The Fascini Cluster Tags: Land Vehicle Dramatis Personae: Previously: http://www.eurobrick...howtopic=137986 Currently, in the Fascini Cluster... Thanks for field testing our latest vehicle, Eshey. What in the avocado is this?!?! It's Octan's latest artillery mech. I call it the Compensator. It's all sorts of wrong! Hmm? I thought you liked firepower. Comments and criticisms are all welcome!
  11. davidroberts01341

    [MOC] Octan 24 - Space Tanker

    A tanker for liquid methane, built for the Octan company by Llwynwgril Space Systems. You read about the source of the methane in the description on Flickr or MOCpages. Octan 24 by David Roberts, on Flickr Octan 24 by David Roberts, on Flickr Octan 24 by David Roberts, on Flickr Octan 24 Cockpit Details by David Roberts, on Flickr
  12. Kodan Black

    [O - H04] The Lab - Pt1

    Location: H04 Crofter's Ridge Tags: Land Vehicle, Civil Building Previously... // PERSONAL DIARY // The Major came to see me and said that my expertise was needed for a very important mission that he and his team were undertaking. I asked him what I could help with and he said that they needed me to go with them to a lab on Crofter's Ridge. I wasn't sure which lab he was referring to and he said it "wasn't one you have heard of." I explained that I was a senior executive and one of the top scientists, so I knew about all the labs and he just said "not this one." I was a bit nervous at this, particularly knowing The Major's line of work, but he told me that good leaders "lead from the front, not behind a desk!" I certainly want to be a good leader! As we boarded the shuttle to head down to the planet's surface I couldn't help but notice that all the other team members wore heavy armor and had plenty of weapons. I asked The Major about my own armor and weaponry and he replied that we didn't know what sort of situation we were heading into and that it would be safer for me if whatever was down there thought of me as a civilian instead of a warrior. It did sort of make sense so I agreed. Once on planet we went down an elevator with The Major's team armed and ready to roll and with me driving a small utility vehicle with tools. Once we reached the floor The Major's team went about securing the area. Which proved unnecessary since there was nothing there. Apparently we were in a kind of outer zone and one of the warriors named Cheyenne (though everyone called her Cyborg) worked at bypassing the security systems to permit us entry to the inner area. I'm not quite sure what happened to her that caused her to have the cybernetic implants, but she clearly wasn't comfortable talking about it. Even after I had asked her and she said it was from "a faraway place she would never go back to." And when I asked her where and why not she just shook her head and stayed quiet. I have to admit it was a bit creepy being in there. There was no real sign of anyone having been there and it was not very well lit. It was eerily quiet, and though the filtration system in my helmet prevented me from smelling anything, the readout showed the air was abnormally clean. I could sense a tension among the soldiers, though The Major did his utmost to hide it. I wanted to point out again that I was an executive now and that it seemed like maybe not ideal to have me along, but I knew it was too late for that argument. They needed my scientific expertise to investigate a lab that was so top secret even I didn't know about it. Extra Pics:
  13. Zaael

    [O-H06] The Chase Begins

    Location: Farmolis - H06 Tags: Land Vehicle - The Return - The Scavenge Hunt - Requested Repairs - Driving Home - Meeting the Family - New Parts Spying guy: "Sir, your intel was correct. Something is being moved." "Sir": "Very well, follow the shipment, comrade. The others will intercept you once you're close." Spying guy: "Yes sir! And sir may I ask where you got that intel?!? We never get intel like this." "Sir": "No." Spying guy: "... yes sir, sorry sir. Going into pursuit now." Garv: "Zaael, come in!!" Garv: "Hello, someone come in!!" Garv: "I am being chased by a speeder and request backup... Does anyone receive this message!?!" The speeder: Note: the truck has already been judged.
  14. Professor Thaum

    [O - H06] The counsellor's meeting

    PREVIOUSLY : Intro Radar : test 1 The Base 1 Sorry for the "no built" in the middle of the pictures, but the prof's lab will be shown in 2, 3 or 4 stories (part by part) It will take the whole 48 x 48 baseplate when finished... LOCATION : H06 - Onboard the O.C.S. Axle, orbiting Farmorlis Tag : Civilian building, Octan BZZZZZZZZZZZZZZZT Counsellor : Ah... At last we meet professor. Here you are appearing before me. Professor : ... and you before me... here's my assistant, Mr Hadvice Fourfree. Counsellor : I don't like your tone professor, we should have meet on Forring weeks ago ! : Forring is no more concern, now, and I was busy... Idleness, cocktails... Enough is enough, professor !! You'll get back in line willingly or not ! Councellor : You go to the Fascini Cluster at once ! You have an hidden radar plant to overlook, that's your area of skill, isn't it ! And after this... if I have time to lose, we'll speak of your recent research... Professor : No kidding ! : Quiet !! I will report to the CEO Pombe if you ... Professor : NOOOOOOOOOOOOOOO !! The terrible Pombe !!! For pity's sake !! Not Pombe !!! I accept !! I'll go to te Fascini Cluster to check the radar !! Hadvice !! Will you make us ready to go as soon as possible !!! H : euh... sure professor. C : At last you're reasonnable, allright. I'll be full of leniency if you go NOW !! P : Yes, I go, but you ! WILL WAIT FOR MY RETURN !! GZZZOOOOOOOOOOOIIIIIIIITTT ! BZZZZZZZZZZZZZZZZZZZZZZZOOT ! C&C welcome... bonus pics tomorrow
  15. pombe

    [O - E11] Lost in Space

    Location: E11 - The Fascini Cluster Tags: Land Vehicle Dramatis Personae: Previously: http://www.eurobrick...howtopic=137678 Currently, in the Fascini Cluster... Hello? Can anybody hear me? I say, this is embarrassing. Is anybody out there? Drinks for whoever responds! Anybody? Comments and criticisms are all welcome!
  16. Kodan Black

    [O - H06] Firearms Training

    Location: H06 Farmolis Tags: Land Vehicle, Civil Building Previously... // PERSONAL DIARY // The Major expanded our training this week to include firearms. We went to a gun range and there were a large variety of weapons to practice with. The Major was there and he had 2 other instructors this time. I liked this better because unlike with the hand weapons training no one was trying to attack me. Dr. Allison seemed to want to spend most of her time getting to know one of the instructors instead of firing for some reason. I, however, enjoyed my time shooting! I know that as a man of science my place is in the lab, but boy is there a thrill being able to fire those weapons! Even with the Major up above me yelling stuff I had a great time. He kept telling me that your weapon is your best friend out in the field. That with "one in the chamber I'm always a threat!" Once more he was yelling from a vehicle, a small personal land walker this time. I think he might be hard of hearing actually and that is why he is always yelling. The combat shotgun was easily my favorite. It was pretty heavy and had a big kick, but boy was it enjoyable sending fire downrange. I know I'll never be spec ops, but it is nice getting out of the lab sometimes and being able to just have some fun. The one guy even offered to help me better blend in. Though it seemed like he mostly just stood in the corner with his goggles on. Extra Pics: More pics: https://www.flickr.c...2136@N04/Mn8DMT
  17. Zaael

    [O-H06] New Parts

    Location: Farmolis - H06 Tags: Military Building, Land Vehicle, Engineering - The Return - The Scavenge Hunt - Requested Repairs - Driving Home - Meeting the Family Garv had to pick up some new batteries in the main city of Farmolis and is now on his way back to Zaael's homebase. Meanwhile somewhere in a heavily protected lab aboard a ship somewhere in Andromeda's Gates: Professor Rachel is reviewing the test results. Results that are disappointing. Zaael had promised something good, but this is bad, really bad, budget cutting bad. The CEO will not be amused, unless Zaael and Rachel can fix it before the next big test run of the "Project". She decides to call Zaael on a secure line to ask him how he is going to fix this. Rachel: "The "Project" is far from working as intended. The whole team is at a loss. I am sending you the results, can you fix this?" Zaael: "Hello Rachel, I am having a few days off, this can wait... Rachel: "No it can't, our CEO is supposed to be here next week for the big test run and if we produce the same results our budget will be cut, maybe the whole project will be cancelled!!" Zaael: "Right haha, you don't really know Pombe, do you?" Rachel: "..." Zaael: "Never mind. If it will ease your mind I can have a quick look. Fey and Maan are shopping anyway... It seems one of the key parts is malfunctioning. I will build a new one and ship it to you." Rachel: "Thank you Zaael!" A few hours later: Garv just returned getting some new batteries with the new Octan Corp truck while Zaael had just finished up building the new component. Perfect timing! Zaael: "Garv, be careful, this thing is dangerous and very important. Be quick and please don't bump into anything!" Garv: "Ok, no problem!" Garv: "I will deliver this before you are back in the house, no worries." Zaael: "I'm serious Garv, no games, no detours, deliver it quick and safe." Garv: "I will, promised." Garv: "Sorry darling, I have just one more delivery to make for Zaael and then we can go hike in the north." Gina: "I heard him say it is a dangerous cargo, be careful sweetheart." Garv: "No worries darling." More pics of the truck: Note: the following builds should not be judged: - the parking lot and the three vehicles in the back there
  18. pombe

    [O - E11] Normalcy

    Location: E11 - The Fascini Cluster Tags: Land Vehicle, Spaceship Dramatis Personae: Previously: http://www.eurobrick...howtopic=136916 Currently, in the Fascini Cluster... Scanning the asteroids for awesomnium now, sir. We're doing an actual assignment?! This one seems to be promising. Then set her down. It's not a poop asteroid, is it?! We've landed, sir. Where are the aliens that come out of no where with normal names and strange occupations, speaking things that only I don't understand?! Lower the ramp, Sue. Beginning my survey. There's no poop, innuendo, or bad science?! What's going on?! Comments and criticisms are all welcome!
  19. Kodan Black

    [O - H06] The Major

    Location: H06 Farmolis Tags: Land Vehicle, Civil Building ** My 52nd weekly build in AG, so I've now done a year's worth of weekly's consecutively!** Previously... // PERSONAL DIARY // We were recently sent a communication from Corporate HQ about a new program to try and make all AG staff better prepared for the harshness of our environment. I think that HQ was concerned for our safety and they tried to illustrate that by saying that losing humans came at "a significant cost." They instructed that we participate in classes led by one of their security staff, Major Richard Allcock. Being a member of the executive team I, of course, knew that I should provide a good example and therefore made sure I was one of the first trained and clearly demonstrated my enthusiasm for the effort to those around me. Dr. Allison and I reported to a training facility for our first class -- "Armed Self Defense: Use the Pointy End". Upon arriving we met the Major (he prefers to be called that), and he explained that he had brought with him some of the finest warriors to train us. They were skilled in fencing, polearms, and many other bladed weapon disciplines. One thing I noticed that was a big shift for me was that the Major always wanted us to yell our answers. If he asked if we understood something we weren't supposed to say "Yes", we should shout loudly: "YES, MAJOR!" Not something you generally do in a science lab. The Major asked Dr. Allison and myself about our military history (none), our previous armed/unarmed defense training (none), and our daily training regimen (apparently "walking to the lab" wasn't a good answer as he had me "drop and give him 20", which meant push ups I learned). Once we had established our lack of skills he went into a several minute profanity laced tirade about being barely more than targets. I attempted to point out that protection was never a concern as I had ED-208 (whom had been forbidden from attending) to keep me safe. I then learned that the Major was not a fan of robots. He asked what I would do when "that damned machine comes for my precious fluids", which I had no answer for as I had no idea what that meant. He asked if I had ever watched the classic "Terminator" series of holovids in which the inevitability of robot revolt was explored. I had not and he said that I should do my research before talking about things. I tried to explain that I had a Masters in Mechanical Engineering, a PhD in robotics and was working on a second PhD in Artificial Intelligence, but he simply said that "book learning ain't a replacement for the real thing." I was the first to face off against my instructors and they gave me a wooden practice sword so I wouldn't hurt anyone. The Major stood on his jeep (I'm not sure why he even had one in the facility or how it got in there, but he said it was necessary) and used his megaphone to yell instructions. Though mostly it was just "attack" or "defend yourself dummy!" I did my best to fend off my far more trained attackers, but it did not go well. I felt like even the training facility cats could have successfully attacked me -- especially the big smelly one. After an hour or so the Major said we were done for the day. I think all that armor must have made him really hot because he said he "needed a drink, like a gallon or so should do." I was very tired but felt like I was better prepared to face the trials of life in AG. After the class I told Dr. Allison I was going to head out to the garden outside the training facility for a bit of meditation on what I had just learned. She said she would catch up with me later and I was left alone with my thoughts. Extra Pics:
  20. pombe

    [O - E11] Fiesta Siesta

    Location: E11 - The Fascini Cluster Tags: Land Vehicle, Civil Building Dramatis Personae: Previously: http://www.eurobrick...howtopic=136916 Currently, in the Fascini Cluster... Eshey, since I'm currently away attending the annual Brick Fiesta convention, would you mind checking on the progress in the engineering bay? Sure, I'll head on over, sir. Oh avocados...what are you guys doing in the engineering bay? Dr. Gene Hackman was helping me develop Octan's latest patrol starship. I'm buying drinks afterwards. You're welcome to join, of course. No one will believe me when I say that the vehicle is a segway and not a starship, will they? Of course, it's a starship, Eshey. How does that even look like a segway? What?! There's a viewscreen in the engineering bay! Why did you even send me down here if you could just access the view screen in the engineering bay and see for yourself? Because, Eshey, I'm not there. I'm busy at Brick Fiesta. WHAT?! YOU'RE LOOKING AT IT RIGHT NOW!!! Hold on. Wait. Why is Dr. Hackman, an astrogeneticist, working on a seg...er...a patrol starship? Shouldn't he be helping Dr. Long with her project? Oh, Dr. Long is busy meeting with royalty of some sort. You know, part of being a famous Octan scientist and all. I figured that since now is then, we could take advantage of Dr. Hackman now. I don't follow...er...let me phrase this differently...when does then become now? Later. What? In any case, Dr. Hackman is adding DNA to our starship prototype. Afterall, if our starships had DNA in them, we wouldn't have to manufacture them anymore. They could simply breed and reproduce, reducing our overhead costs. Comments and criticisms are all welcome!
  21. Location: H06 Farmolis Tags: Land Vehicle, Civil Building Previously... // PERSONAL DIARY // After having a bit of a break I got back into work by helping Dr. Allison with a new speeder prototype. It was designed to be used as a long range exploration speeder for our explorer teams. It has a larger cargo capacity for more consumables and heavier lifting engines to handle the heavier load. While not designed as a high velocity speeder it can achieve very quick speeds and has a large energy output capability so it can be used to power a small encampment when needed. The underside has an armored skid and the seating area features armored plates to protect against foliage or more malicious threats. It isn't a full military vehicle, but with so many unknown alien threats this speeder should be very capable and help keep our people safe. Dr. Allison had been working on fixing the little issues she had been made aware of during testing and I was happy to help out. ED-208 kept insisting he could fix it, but all he wanted to do was use the giant sledgehammer. I doubted that even his robotic capabilities were enough to use that with precision. The prototype lab itself was a very impressive facility. Dr. Allison had modified it some to make it more in line with her personal decor tastes which isn't standard Octan practice, but I thought that Dr. Long would approve since it did seem to foster a stronger work ethic. I also like to allow people a bit of discretion when possible as it empowers them and gives them a sense of pride and ownership. I'm not saying to allow people to go crazy, I'm not pombe! But some minor personal touches do statistically prove out to be beneficial in helping an employee blur the lines a bit between work and personal time thus generally leading to more hours spent at work. Of course I'm sure many employees are like me and do plenty of work when away from the office also. The wonderful part of being so connected everywhere is that I can be out to dinner or at a park and still able to do work! Extra Pics: Side Note: I think this lab is my most "complete" facility build yet.
  22. mediumsnowman

    [O - H06] Checkpoint Charlie

    Location: H06 - Farmolis Tags: Civil, Building, Land Vehicle "Welcome to Checkpoint Charlie. Please state your purpose and provide identification." "Jebediah O'Reilly, bringing a tanker of Awesomenium for Dr. Kodan Black." "Yes, you're scheduled right here. Dr. Black is expecting you. Retinal scan checks out... you may proceed." "Have a nice day." It's been a while since I posted something... it's good to be back! C&C welcome, as always.
  23. Zaael

    [O-H06] Meeting the Family

    Location: Farmolis - H06 Tags: Civil Building (?) - The Return - The Scavenge Hunt - Requested Repairs - Driving Home After a long drive Zaael arrives at his home on Farmolis. His wife Fey is waiting for him with their daughter Maan. Garv, the mechanic and Zaael's long time friend is also there. Anxious to see his little one Zaael parks his OC.GF12 at its parking spot next to his two speeders and runs over to Fey. Garv meanwhile prepares to make the Roadster ready, just in case. "Hi honey, how's our little one doing?" Note: the vehicles in this build are all previously judged. Below the build to be judged: Extra pics:
  24. pombe

    [O - E11] A CAT GAG

    Location: E11 - The Fascini Cluster Tags: Spaceship, Civil Building Dramatis Personae: Previously: http://www.eurobrick...howtopic=136564 Currently, in the Fascini Cluster... Sir, what are we doing out here in the Fascini Cluster? Shouldn't you be preparing some sort of public response to the death of Kawashita's Agent Raven? Speaking of which, you've been silent on the death of John Hannibal. I know he was a good friend of yours. John understood that the now is more important than the then. We will mourn his passing when the then is now. What? Same with Agent Raven. The then is then right now. And speaking of right now, we have a unique opportunity to help our recently returned Dr. Long. She has been gathering many scientists for a very important project. So we're here to help Dr. Long, then? <sigh> No, Eshey. Pay attention. We are here to help her now. Helping her then would be too late. Anyways, I have invited a renown intergalactic astrogeneticist to join her efforts. He agreed and asked us to meet him here. In fact, his shuttle just docked with us. Then he's just arrived? No, Eshey. <sigh> He's arriving now. Welcome aboard, Doctor. Dr. Gene Hackman, this is my associate, Eshey Kolai. Eshey, this is renown astrogeneticist, Dr. Gene Hackman. HOLY AVOCADOS!!! HE'S AN ALIEN!!! KILL HIM KILL HIM!!! [ <sigh> My sincere apologies, Dr. Hackman. My associate is obviously having some sort of meltdown. TACGGAACTACTGGGATACA. GGGAACATACTATCATTTAGAC. CATTAGGAACATAGAAGATTCAGACAGTACCGCTGAATAGCA. ACATAGCGATTACATGACGATGACTATGCATACG. CGAGATTTACGTATAGCAGTACATAGACTGCGCAGATGA. You think maybe this is some sort of inherited genetic condition and you'd like to examine her? AGTCGACTACTGGGATAAAGACGACA. GGCAGGGACTATACGAACATACTATACCTATATTGAG. GGCATATCGTTAGGAACAGTTACATTCAGACAGTACCAGACTTAGGACGA. GACTTAGCACTATGGAC. AGCTTTTTAGCTATACGAATGATG. It would be an honor to have you experiment on my associate. Comments and criticisms are all welcome!
  25. Zaael

    [O-H06] Driving Home

    Location: Farmolis - H06 Tags: Land Vehicle - The Return - The Scavenge Hunt - Requested Repairs After his last mission Zaael was ordered to work on a super secret project. That project is finished and Z rushes home to finally be with his wife and his daughter again. Extra pics: